Journal: Scientific Reports

Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes

doi: 10.1038/s41598-021-95308-9

Figure Lengend Snippet: Validation of human ACE2 antibodies for flow cytometry. ( a ) Immunoblot of endogenous ACE2 against lysates from a panel of immortalized cell lines. ( b ) Immunoblot of heterologous overexpressed ACE2 in HEK293T cells. ( c ) Quantification of surface ACE2 mean fluorescence intensity (MFI) by flow cytometry with a panel of 13 commercial antibodies against parental and ACE2-overexpressing HEK293T cells. Antibody sources are listed in Table . ( d ) Immunoblot of endogenous ACE2 in HuH7 and Calu-3 cell lines generated by CRISPR with either a nontargeting or ACE2 -targeting gRNA. ( e ) Quantification of mean fluorescence intensity (MFI) of endogenous ACE2 at the cell surface by flow cytometry in HuH7 and Calu-3 cell lines generated by CRISPR with either a nontargeting or ACE2 -targeting gRNA, comparing the two commercial antibodies that exhibited specific ACE2 staining in 1C. Asterisk indicates p < 0.05 by two-tailed Student’s t test. Error bars represent standard deviation. All immunoblots for ACE2 were performed with GeneTex #GTX01160.

Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang).

Techniques: Flow Cytometry, Western Blot, Fluorescence, Generated, CRISPR, Staining, Two Tailed Test, Standard Deviation

Journal: Scientific Reports

Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes

doi: 10.1038/s41598-021-95308-9

Figure Lengend Snippet: Heterogeneous ACE2 surface abundance in HuH7 and Calu-3 cells. ( a ) Surface staining of endogenous ACE2 by flow cytometry in HuH7 and Calu-3 cells targeted by CRISPR with either a nontargeting or ACE2 -targeting gRNA. ( b ) Proportion of ACE2-positive cells as determined by flow cytometry in HuH7 and Calu-3 cells targeted by CRISPR with either a nontargeting or ACE2 -targeting gRNA. Dashed lines represent background signal in wild-type cells stained with secondary antibody only. ( c ) Comparison of mean forward and side scatter parameters as determined by flow cytometry in gated ACE2-negative and ACE2-positive HuH7 cell populations. ( d ) Confocal immunofluorescence microscopy of HuH7 cells with endogenous ACE2 (green) and Hoechst nuclear staining (blue). Scale bar = 50 µm. ( e ) ACE2-positivity by flow cytometry within each phase of the cell cycle, as determined by propidium iodide staining. ( f ) ACE2-positivity as determined by flow cytometry in wild-type HuH7 cells harvested at a range of cell densities. Asterisk indicates p < 0.05 by two-tailed Student’s t test. Error bars represent standard deviation. All ACE2 immunofluorescence and flow cytometry experiments in this figure were performed with R&D #MAB9332.

Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang).

Techniques: Staining, Flow Cytometry, CRISPR, Immunofluorescence, Microscopy, Two Tailed Test, Standard Deviation

Journal: Journal of Virology

Article Title: Thiopurines Activate an Antiviral Unfolded Protein Response That Blocks Influenza A Virus Glycoprotein Accumulation

doi: 10.1128/JVI.00453-21

Figure Lengend Snippet: Genetic deletion of PERK enhances the antiviral effect of 6-TG. (A) Western blotting of PERK KO cells (clone B3) and nontargeting control gRNA lentivirus-transduced cells (NT) treated with 1 μM thapsigargin (Tg) or 500 μM sodium arsenite (As). Lysates were collected at 1 h post-treatment and analyzed for PERK expression and activation and total and phosphorylated eIF2α. (B) A549 PERK KO cells (clones A2, B3, and C3) and the nontargeting control cell line were infected with PR8 at an MOI of 0.1 and treated with tunicamycin (TM) (5 μg/ml), 6-thioguanine (6-TG) (10 μM), and 6-mercaptopurine (6-MP) (10 μM) for 23 h. The supernatant was collected at 24 hpi, and viral progeny were quantified by plaque assay. Statistical significance was calculated via two-way ANOVA followed by a Dunnett multiple-comparison test (only a subset of statistically significant differences is highlighted with asterisks for clarity). (C) A549 PERK KO clone B3 and nontargeting control cells were treated with escalating doses of 6-TG, 6-TGo, or the vehicle control for 23 h, and cell viability was measured using an alamarBlue assay. Relative fluorescence units were normalized to the vehicle control. Error bars represent standard deviations ( n = 3).

Article Snippet: The lentiCRISPR-v2 plasmids encoding guide RNAs (gRNAs) targeting human PERK or a nontargeting (NT) guide RNA control were cloned with primer sequences designed using the Broad Institute GPP Web portal ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ).

Techniques: Western Blot, Control, Expressing, Activation Assay, Clone Assay, Infection, Plaque Assay, Comparison, Alamar Blue Assay, Fluorescence

Journal: Developmental Dynamics

Article Title: Hypoxia inducible factor‐2α importance for migration, proliferation, and self‐renewal of trunk neural crest cells

doi: 10.1002/dvdy.253

Figure Lengend Snippet: CRISPR/Cas9 mediated knockout of hypoxia inducible factor (HIF)‐2α delays embryogenesis. A, Immunofluorescent staining for HIF‐2α in embryos electroporated with control (CTRL) or HIF‐2α (EPAS1.2) targeting gRNAs. Arrowheads denote GFP+ cells lacking HIF‐2α in knockout embryos. Sections from trunk. B, Relative mRNA expression measured by qRT‐PCR. WT, wild‐type HH18 embryos. C,D, Determination of developmental age 36 hours postelectroporation with a nontargeting (CTRL) gRNA compared to three different gRNAs targeting EPAS1 (EPAS1.1, EPAS1.2, EPAS1.3) as assessed by head‐ and tail morphology (converted to Hamburger Hamilton [HH] stages, C. Number of embryos analyzed were n = 14 [CTRL], n = 10 [EPAS1.1], n = 14 [EPAS1.2], and n = 14 [EPAS1.3]) or by counting somites ex ovo. (D, Number of embryos analyzed were n = 8 [CTRL], n = 13 [EPAS1.1], and n = 14 [EPAS1.3].) Statistical significance was determined by one‐way analysis of variance (ANOVA), comparing nontargeting CTRL to each individual EPAS1 gRNA. E‐G, Relative mRNA expression of trunk neural crest, E, neural crest, F, and cranial neural crest, G, associated genes in dissected trunk axial level derived neural tube tissue, measured by qRT‐PCR 36 hours postelectroporation. Data presented as mean of n = 2 biologically independent repeats, error bars denote SEM, B,E‐G. Statistical significance was determined by two‐sided student's t test, comparing nontargeting CTRL with each individual EPAS1 gRNA

Article Snippet: CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′; EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc; 3′; EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9‐GFP (#99138, Addgene) at 2 μg/μL.

Techniques: CRISPR, Knock-Out, Staining, Control, Expressing, Quantitative RT-PCR, Derivative Assay

Journal: Developmental Dynamics

Article Title: Hypoxia inducible factor‐2α importance for migration, proliferation, and self‐renewal of trunk neural crest cells

doi: 10.1002/dvdy.253

Figure Lengend Snippet: Dysregulation of hypoxia inducible factor (HIF)‐2α expression affects migration of trunk neural crest cells. A‐E, Immunostaining of HNK1 (red) marking migrating crest cells in one‐sided electroporated embryos (right side). Electroporated cells (nontargeting CTRL gRNA, A, gRNA #2 targeting EPAS1 (EPAS1.2; B), 5′‐mispair morpholino, D, or EPAS1 morpholino, E) are seen in green. DAPI was used to counterstain nuclei. Embryo sections from trunk axial level are from 36 hours, A,B, or 44 hours, D,E, postelectroporation. Arrowheads highlight the difference in HNK1+ area in control vs electroporated side. C,F, Quantification of area positive for HNK1. Area on electroporated side in EPAS1.2, B, or EPAS1 morpholino, E, embryos was normalized to that of respective control side. Data are presented as mean ± SEM. Statistical significance was calculated using one‐way analysis of variance (ANOVA)

Article Snippet: CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′; EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc; 3′; EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9‐GFP (#99138, Addgene) at 2 μg/μL.

Techniques: Expressing, Migration, Immunostaining, Control

Journal: Developmental Dynamics

Article Title: Hypoxia inducible factor‐2α importance for migration, proliferation, and self‐renewal of trunk neural crest cells

doi: 10.1002/dvdy.253

Figure Lengend Snippet: Sox9 expression is not affected by dysregulated levels of Hypoxia inducible factor (HIF)‐2a. A‐C, Immunostaining of Sox9 (red) in one‐sided electroporated embryos (right side). Electroporated cells (nontargeting gRNA [CTRL, A] or gRNA #1 [EPAS1.1, B] and #3 [EPAS1.3, C] targeting EPAS1) are seen in green. DAPI was used to counterstain nuclei. Embryo sections from trunk axial level are from 36 hours postelectroporation

Article Snippet: CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′; EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc; 3′; EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9‐GFP (#99138, Addgene) at 2 μg/μL.

Techniques: Expressing, Immunostaining

Journal: Science translational medicine

Article Title: Ubiquitination and degradation of SUMO1 by small-molecule degraders extends survival of mice with patient-derived tumors

doi: 10.1126/scitranslmed.abh1486

Figure Lengend Snippet: (A and B) CRISPR-Cas9 FBXO42 knockout (sgFBXO42-3 and sgFBXO42-D2) and sgRNA control (sgControl) HCT116 clones were treated with HB007 for 72 hours and analyzed by Western blot for conjugated SUMO1 (A), dot blots for SUMO1 total amounts [(B) top], and cell viability assay for cell growth inhibition [(B) bottom)] (means ± SD; n = 3; ***P < 0.001 by unpaired t test). (C) Flag-FBXO42 and YFP-SUMO1-GV were cotransfected in HCT116 or LN229 cells. After 24 hours of treatment with HB007, the cells were subjected to Flag IP and Western blots using a GFP/YFP antibody for the interaction of FBXO42 and SUMO1. (D) Flag-CUL1, CUL2, or CUL3 was cotransfected with YFP-SUMO1-GV in HCT116 cells, and after treatment with HB007 for 48 hours, the cells were subjected to Flag IP and Western blots using GFP/YFP antibodies for the interaction of SUMO1 and CUL1, CUL2, or CUL3. (E) The FBXO42 knockout sg-FBXO42-3, sg-FBXO42-D2, and sgRNA control HCT116 clone were transfected with YFP-SUMO-GV and Flag-CUL1; treated with HB007 for 24 hours; and subjected to Flag IP and Western blot. (F) The sgRNA control and sg-FBXO42-D2 (left) or sg-FBXO42-3 HCT116 clone (right) was transfected with Flag-SUMO1-GV and HA-UB, treated with HB007 for 24 hours, and subjected to Flag IP and Western blot for SUMO1 polyubiquitination (top) and densitometry analysis of the HA-UB blots for the poly-UB amounts (bottom) (n = 2). (G) HCT116 cells were cotransfected with Flag-SUMO1-GV, Myc-FBXO42, and/or HA-UB; treated or untreated with HB007 for 24 hours; and subjected to Flag IP and Western blotting for SUMO1 polyubiquitination. (H) LN229 cells were treated with MLN4924 for 24 hours, alone or in combination with HB007, and analyzed by Western blots for conjugated SUMO1 and neddylated or unneddylated CUL1 as indicated (right).

Article Snippet: The sequences for nontargeting control CRISPR (Addgene, #80248) were as follows: Oligo1 (5′- CACCGGTATTACTGATATTGGTGGG-3′) and Oligo2 (5′-AAACCCCACCAATATCAGTAATACC-3′).

Techniques: CRISPR, Knock-Out, Control, Clone Assay, Western Blot, Viability Assay, Inhibition, Transfection

Journal: Science translational medicine

Article Title: Ubiquitination and degradation of SUMO1 by small-molecule degraders extends survival of mice with patient-derived tumors

doi: 10.1126/scitranslmed.abh1486

Figure Lengend Snippet: (A) Venn diagram of the data from genome-scale CRISPR-Cas9 knockout screen, HB007-FG bead and HB007-biotin/streptavidin-coated bead pull-down (top), and spectrometric total peptides counts of CAPRIN1 from LC-MS/MS analysis (bottom). (B) HB007-biotin was incubated with rhCAPRIN1 in the presence or absence of free HB007 and pulled down by streptavidin-coated beads and tested by immunoblotting for the binding of rhCAPRIN1 to HB007-biotin, with rhCAPRIN1 (5%) used as the loading control. (C) rhCAPRIN1 was premixed with 1 μM biotin, followed by HB007-biotin/streptavidin-coated bead pull-down in the presence of various doses of HB007. CAPRIN1 binding was identified by immunoblotting using CAPRIN1 antibodies. (D and E) HB007-FG beads and HB007-biotin were incubated with HCT116 lysate (D) and LN229 lysate (E) added or not with free HB007, and the pull-downs were tested by immunoblotting for the binding of cellular CAPRIN1 to HB007. (F) Immunoblot of HB007-biotin/streptavidin pull-down of HCT116 lysate added or not with the indicated concentrations of CPD1 or HB007. (G) The CPD1 similar but inactive compounds CID: 11208948 or CID: 789482 (top) or HB007 was added to HCT116 lysate that was then incubated with HB007-biotin. HB007-biotin/streptavidin pull-down was analyzed by immunoblotting. (H) Representative BLI sensorgrams of the interactions between rhCAPRIN1 and biotinylated HB007. Plots of the binding response during the association (0 to 600 s) and dissociation (600 to 1200 s) periods of the BLI assay at varying concentrations of CAPRIN1 (top) when HB007-biotin–loaded biosensors (quenched with biocytin) were dipped in CAPRIN1 wells. The plots have been processed with the double referencing technique and aligning of x and y axes. The red curves indicate the fit data. Residual binding for each plot at the varying concentrations (bottom). Binding curves were fit globally to a 1:1 binding model to calculate the binding constant (KD) from kinetic analysis as the ratio of the association (koff) and dissociation (kon) rate constants.

Article Snippet: The sequences for nontargeting control CRISPR (Addgene, #80248) were as follows: Oligo1 (5′- CACCGGTATTACTGATATTGGTGGG-3′) and Oligo2 (5′-AAACCCCACCAATATCAGTAATACC-3′).

Techniques: CRISPR, Knock-Out, Liquid Chromatography with Mass Spectroscopy, Incubation, Western Blot, Binding Assay, Control

Journal: The Journal of Clinical Investigation

Article Title: ADAMTS12 promotes fibrosis by restructuring extracellular matrix to enable activation of injury-responsive fibroblasts

doi: 10.1172/JCI170246

Figure Lengend Snippet: ( A ) COL1A1 RT-qPCR ( P NTG TGF-β vs. ADAMTS12-KO TGF-β = 0.003) in human PDGFRβ + kidney cells with either CRISPR/Cas9-induced ADAMTS12-KO or NTG RNA transduction after treatment with TGF-β or vehicle ( n = 4 per group). Results were reproduced in 3 independent experiments. ( B ) Volcano plot of DEGs in WT versus ADAMTS12- KO PDGFRβ + cells ( n = 4 per group). ( C ) PROGENy pathway analysis of the DEGs shown in B . ( D ) Top enriched biological process GO terms based on the top downregulated genes in ADAMTS12- KO cells shown in B . (For abbreviations, see .) ( E ) Trajectory maps of the migration of WT and ADAMTS12 -KO PDGFRβ + cells after treatment with vehicle or TGF-β. Quantification of the average speed per field of view ( P NTG TGF-β vs. ADAMTS12-KO TGF-β = 0.0016). Results were reproduced in 3 independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001, by 2-way ANOVA with Tukey’s post hoc test.

Article Snippet: In summary, ADAMTS12 -specific guide RNA (forward 5′-CACCGAACATCATAGATCACTCCGG-3′; reverse 5′-AAACCCGGAGTGATCTATGATGTTC-3′) and a control nontargeting guide (NTG) RNA were subcloned into pL-CRISPR.EFS.GFP (57818, Addgene) using BsmBI restriction digestion.

Techniques: Quantitative RT-PCR, CRISPR, Transduction, Migration